Problem 18
Question
You have discovered a novel protein that has a \(\mathrm{pI}=5.5\). To study the functional properties of this new protein, your research group has made a mutant that contains two amino acid changes - namely, a surface Phe residue in the normal protein has been replaced by His (side chain \(\mathrm{p} K_{\mathrm{a}}=6.1\) ) and a surface Gln has been replaced by Glu (side chain \(\mathrm{p} K_{\mathrm{a}}=6.0\) ). Is the pI of the mutant protein predicted to be greater than, less than, or the same as the pI of the normal protein? Support your answer with the appropriate calculation.
Step-by-Step Solution
Verified Answer
The mutant protein's pI is predicted to be less than 5.5 due to the mutations.
1Step 1: Understand the Problem
We need to determine whether the isoelectric point (pI) of a mutant protein is greater than, less than, or the same as a normal protein with a pI of 5.5. The mutation involves replacing Phe with His (pKa=6.1) and Gln with Glu (pKa=6.0).
2Step 2: Define Key Terms
The isoelectric point (pI) of a protein is the pH at which the protein carries no net charge. Amino acids contribute to the protein's net charge based on their ionizable side chains, which have specific pKa values. Altering these side chains can affect the pI.
3Step 3: Determine Effects of Mutation
Replacing a non-ionizable Phe with His adds an ionizable group to the protein, with a pKa of 6.1. This means His can gain a positive charge below pH 6.1. Gln is replaced by Glu, introducing a group that can carry a negative charge above pH 6.0.
4Step 4: Analyze the Changes
The introduction of His, which starts with a positive charge below pH 6.1, raises the net positive charge in a certain pH range, while Glu introduces a negative charge above pH 6.0. These mutations shift the protein's balance of positive and negative charges.
5Step 5: Predict the pI Change
To remain neutral, the pI is affected by how His and Glu impact the charge balance. His with higher positive charge below 6.1 and Glu decreases the pI due to its strong negative influence above pH 6.0.
Key Concepts
Amino Acid MutationsProtein Charge BalanceSide Chain Ionization
Amino Acid Mutations
Amino acid mutations involve changes in the protein sequence by substituting one amino acid for another. This can significantly affect a protein's structure, stability, and function. In our example, two mutations were introduced:
- Phe (phenylalanine), a non-polar amino acid, was replaced by His (histidine), which possesses an ionizable side chain.
- Gln (glutamine), a polar but uncharged amino acid, was replaced by Glu (glutamic acid), known for its negatively charged side chain.
Protein Charge Balance
The charge of a protein is determined by the sum of charges from its amino acids. At any given pH, a protein may have a positive, negative, or neutral charge. This balance is a dynamic feature that changes with pH and depends highly on the presence of ionizable side chains.
In the scenario described, the mutation of specific amino acids can shift the balance of charges on the protein:
- His addition can raise the positive charge content of the protein below its pKa of 6.1 as it helps in protonation.
- Glu adds a potential negative charge above its pKa of 6.0 when deprotonated.
Side Chain Ionization
Side chain ionization is critical for determining the behavior of proteins in different pH environments. Each ionizable side chain in a protein has a specific pKa value, where it shifts from being protonated to deprotonated.
For histidine (His),
- The side chain has a pKa of 6.1, allowing it to gain a proton below this pH, thereby positively charging the protein.
- With a pKa of 6.0, loses a proton above this pH and thus imparts a negative charge.
Other exercises in this chapter
Problem 13
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. \(5^{\prime} \ldots\) GCCAUGUUUCCGAGUUAUCCCAA
View solution Problem 15
Acetylating agents such as acetic anhydride react preferentially with primary amines, iodoacetate reacts preferentially with sulfhydryl groups (see Tools of Bio
View solution Problem 20
Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE and another on the sequence KRTIAAVNSPLLEVATY. Which search do you predict will giv
View solution Problem 9
A mutant form of polypeptide hormone angiotensin II has the amino acid composition (Asp, Arg, Ile, Met, Phe, Pro, Tyr, Val) The following observations are made:
View solution