Problem 15
Question
Acetylating agents such as acetic anhydride react preferentially with primary amines, iodoacetate reacts preferentially with sulfhydryl groups (see Tools of Biochemistry 5B), and ATP-dependent kinases preferentially add a phosphoryl group to side-chain hydroxyl or phenolic - \(\mathrm{OH}\) groups. Which amino acid side chains, or main-chain groups, in a polypeptide are most likely to be modified by treatment with: (a) acetic anhydride (b) iodoacetate (c) a kinase + ATP
Step-by-Step Solution
Verified Answer
(a) Lysine; (b) Cysteine; (c) Serine, Threonine, Tyrosine.
1Step 1: Identify Primary Amines for Acetic Anhydride Reactivity
Acetic anhydride reacts preferentially with primary amines. In amino acids, the side chain of lysine is a primary amine. Therefore, the lysine side chain in polypeptides is likely to be modified by acetylation when treated with acetic anhydride.
2Step 2: Determine Sulfhydryl Reactivity for Iodoacetate
Iodoacetate reacts specifically with sulfhydryl groups. Cysteine is the amino acid that contains a sulfhydryl group in its side chain (-SH). Thus, cysteine residues in a polypeptide are likely to be modified by iodoacetate treatment.
3Step 3: Identify Hydroxyl Groups for Kinase Reactivity
Kinases catalyze the transfer of a phosphoryl group to side-chain hydroxyl (-OH) groups. The amino acids serine, threonine, and tyrosine have side-chain hydroxyl groups. Therefore, these residues are targets for phosphorylation when treated with a kinase and ATP.
Key Concepts
Acetylating AgentsPhosphorylationSulfhydryl Groups
Acetylating Agents
Acetylating agents, such as acetic anhydride, have a special preference for reacting with primary amines. Primary amines are found in the side chains of certain amino acids.
For example, lysine is an amino acid that contains a primary amine in its side chain. This makes it a perfect candidate for acetylation by acetic anhydride. Acetylation is a chemical reaction where an acetyl group is transferred to a molecule.
Here's why acetylation is important:
For example, lysine is an amino acid that contains a primary amine in its side chain. This makes it a perfect candidate for acetylation by acetic anhydride. Acetylation is a chemical reaction where an acetyl group is transferred to a molecule.
Here's why acetylation is important:
- Acetylation of lysine can affect the stability and function of proteins.
- It may help regulate DNA accessibility, making it an important factor in gene expression.
- Knowing how acetylating agents work helps understand enzymatic processes and the role of modifications in cells.
Phosphorylation
Phosphorylation involves the addition of a phosphoryl group, commonly catalyzed by enzymes called kinases. These enzymes require energy in the form of ATP to add the phosphoryl group to specific side chains.
Amino acids like serine, threonine, and tyrosine have hydroxyl (-OH) groups on their side chains. These serve as typical targets for kinases during phosphorylation.
The importance of phosphorylation cannot be overstated:
Amino acids like serine, threonine, and tyrosine have hydroxyl (-OH) groups on their side chains. These serve as typical targets for kinases during phosphorylation.
The importance of phosphorylation cannot be overstated:
- It plays a crucial role in controlling protein function and activity.
- Phosphorylation can activate or deactivate enzymes and receptors, thus influencing signal transduction pathways.
- It's essential in cellular processes such as cell cycle regulation, growth, and apoptosis.
Sulfhydryl Groups
Sulfhydryl groups, represented as -SH, are functional groups found in the amino acid cysteine. These groups are highly reactive, making them a target for specific chemical reactions.
Iodoacetate is one such agent that targets sulfhydryl groups. When it reacts with cysteine, it forms a stable covalent bond. This modification can impact protein functions by altering disulfide bonds, which are important for the structural stability of proteins.
Here are some key points about sulfhydryl group reactivity:
Iodoacetate is one such agent that targets sulfhydryl groups. When it reacts with cysteine, it forms a stable covalent bond. This modification can impact protein functions by altering disulfide bonds, which are important for the structural stability of proteins.
Here are some key points about sulfhydryl group reactivity:
- Cysteine is distinct among amino acids due to its sulfhydryl group, making it a focus for reactions like disulfide bond formation and reduction.
- Modifying sulfhydryl groups can change protein activities and molecular interactions.
- Understanding the reactivity of these groups is crucial in fields like drug development and enzyme engineering.
Other exercises in this chapter
Problem 9
A mutant form of polypeptide hormone angiotensin II has the amino acid composition (Asp, Arg, Ile, Met, Phe, Pro, Tyr, Val) The following observations are made:
View solution Problem 13
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. \(5^{\prime} \ldots\) GCCAUGUUUCCGAGUUAUCCCAA
View solution Problem 18
You have discovered a novel protein that has a \(\mathrm{pI}=5.5\). To study the functional properties of this new protein, your research group has made a mutan
View solution Problem 20
Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE and another on the sequence KRTIAAVNSPLLEVATY. Which search do you predict will giv
View solution