Problem 20
Question
Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE and another on the sequence KRTIAAVNSPLLEVATY. Which search do you predict will give you alignments with "expect scores" closer to one? Explain your reasoning.
Step-by-Step Solution
Verified Answer
The longer sequence (KRTIAAVNSPLLEVATY) will likely have expect scores closer to one due to its length and increased chance of random matches.
1Step 1: Understand BLAST Expect Scores
BLAST (Basic Local Alignment Search Tool) is used to compare a query sequence against a database to identify similar sequences. An important metric in BLAST is the "expect score" or E-value, which indicates the number of hits you can expect to find by chance when searching a database. The lower the E-value, the more significant the match.
2Step 2: Analyze Sequence Length
The peptide sequence FIDPWE consists of 6 amino acids, while KRTIAAVNSPLLEVATY contains 17 amino acids. Longer sequences have a higher probability of random matches in a database, which can result in higher E-values (less significant matches), while shorter sequences might have fewer matches and generally lower E-values if they align well.
3Step 3: Consider Sequence Complexity
Both sequences should be examined for their complexity. A sequence with a higher complexity is more likely to have significant matches against a database. FIDPWE is relatively short and does not have obvious low-complexity regions or repetitions. KRTIAAVNSPLLEVATY is longer and could have regions that lead to higher E-values due to its chance of random alignments increasing with length.
4Step 4: Predict Impact on E-value
Given that FIDPWE is shorter and likely specific, it generally results in fewer matches than a longer sequence like KRTIAAVNSPLLEVATY, potentially producing a lower E-value. The longer sequence's expectation score might be closer to one as it could find more random matches, increasing the chance of non-specific alignments.
Key Concepts
Peptide Sequence AlignmentE-value SignificanceSequence ComplexityDatabase Search Strategy
Peptide Sequence Alignment
Peptide sequence alignment refers to the comparison of two or more protein sequences in an effort to identify regions that are similar. This helps in understanding functional, structural, or evolutionary relationships between the sequences. In the case of BLAST, the alignment process attempts to place similar sequences in a linear fashion to achieve the maximum possible similarity or identity.
When performing a peptide sequence alignment, one should consider the lengths of the sequences being compared. Shorter sequences can often result in fewer possible alignments, because there are fewer permutations for arrangement. Consequently, the specificity of these alignments can be higher if they match well.
Longer sequences, like KRTIAAVNSPLLEVATY, present more complexities due to their length, which allows more potential matches. However, these matches might also be less reliable or significant due to the increased probability of random alignments. As a result, accurate alignment scoring and significance determination, like through the E-value, are essential in understanding the true relation between sequences.
When performing a peptide sequence alignment, one should consider the lengths of the sequences being compared. Shorter sequences can often result in fewer possible alignments, because there are fewer permutations for arrangement. Consequently, the specificity of these alignments can be higher if they match well.
Longer sequences, like KRTIAAVNSPLLEVATY, present more complexities due to their length, which allows more potential matches. However, these matches might also be less reliable or significant due to the increased probability of random alignments. As a result, accurate alignment scoring and significance determination, like through the E-value, are essential in understanding the true relation between sequences.
E-value Significance
E-value or "expect score" is a measure used in sequence alignment tools like BLAST to determine the significance of the alignment match. It represents the number of hits one can "expect" to see by chance, and a low E-value means that an alignment is rare enough to be considered statistically significant.
In practice, E-values are influenced by several factors:
For instance, a short peptide sequence such as FIDPWE, if aligned well, could present significantly lower E-values when compared to random alignment events. Lengthy sequences, like KRTIAAVNSPLLEVATY, increase the chance of coincidental matches, generally resulting in higher E-values.
Understanding E-values is crucial in distinguishing meaningful biological similarities from mere coincidences.
In practice, E-values are influenced by several factors:
- Sequence length: Short sequences often result in lower E-values, if paired snippets do not occur randomly.
- Sequence complexity: Unique sequences with high complexity typically correlate with low E-values.
For instance, a short peptide sequence such as FIDPWE, if aligned well, could present significantly lower E-values when compared to random alignment events. Lengthy sequences, like KRTIAAVNSPLLEVATY, increase the chance of coincidental matches, generally resulting in higher E-values.
Understanding E-values is crucial in distinguishing meaningful biological similarities from mere coincidences.
Sequence Complexity
Sequence complexity refers to how complex or simple a sequence is based on its constituent elements. A sequence exhibiting higher complexity will generally contain varied amino acid combinations with no overly repetitive motifs. This makes them more likely to stand out against database entries, resulting in lower E-values if a match is found.
Low complexity regions, such as those with repeated patterns or common motifs, may yield higher E-values because they're predicted to occur more frequently simply by chance. Such simplicity might lead to less reliable alignments, raising doubts about their biological significance.
Thus, BLAST users often apply filters to mask low-complexity areas, ensuring that alignment reflects more meaningful biological similarity. In essence, the complexity of a sequence influences its likelihood of finding significant matches in the database.
Low complexity regions, such as those with repeated patterns or common motifs, may yield higher E-values because they're predicted to occur more frequently simply by chance. Such simplicity might lead to less reliable alignments, raising doubts about their biological significance.
Thus, BLAST users often apply filters to mask low-complexity areas, ensuring that alignment reflects more meaningful biological similarity. In essence, the complexity of a sequence influences its likelihood of finding significant matches in the database.
Database Search Strategy
The strategy behind conducting BLAST searches involves maximizing both the speed and accuracy of finding meaningful matches. This involves setting appropriate parameters and expectations based on knowledge of the target database and the query sequences.
Successful database searching requires:
For sequences like FIDPWE and KRTIAAVNSPLLEVATY, understanding the database’s content ensures the identification of truly biologically relevant similar sequences. Strategizing effectively can distinguish between prospective random alignments and those worthy of further biological consideration.
Successful database searching requires:
- Choosing the right database: Depending on the organism or the type of sequence, different databases might yield better results.
- Adjusting search parameters: For instance, modifying E-value thresholds can help match significant sequences while filtering out likely noise.
- Considering computational resources: Efficient searches utilize computational power without overexerting it unnecessarily.
For sequences like FIDPWE and KRTIAAVNSPLLEVATY, understanding the database’s content ensures the identification of truly biologically relevant similar sequences. Strategizing effectively can distinguish between prospective random alignments and those worthy of further biological consideration.
Other exercises in this chapter
Problem 15
Acetylating agents such as acetic anhydride react preferentially with primary amines, iodoacetate reacts preferentially with sulfhydryl groups (see Tools of Bio
View solution Problem 18
You have discovered a novel protein that has a \(\mathrm{pI}=5.5\). To study the functional properties of this new protein, your research group has made a mutan
View solution Problem 13
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. \(5^{\prime} \ldots\) GCCAUGUUUCCGAGUUAUCCCAA
View solution