Problem 9
Question
A mutant form of polypeptide hormone angiotensin II has the amino acid composition (Asp, Arg, Ile, Met, Phe, Pro, Tyr, Val) The following observations are made: \- Trypsin yields a dipeptide containing Asp and Arg and a hexapeptide with all the rest. \- Cyanogen bromide cleavage yields a dipeptide containing Phe and Pro and a hexapeptide containing all the others. \- Chymotrypsin cleaves the hormone into two tetrapeptides, of composition (Asp, Arg, Tyr, Val) and (Ile, Met, Phe, Pro) \- The dipeptide of composition (Pro, Phe) cannot be cleaved by either chymotrypsin or carboxypeptidase. What is the sequence of angiotensin II?
Step-by-Step Solution
Verified Answer
The sequence of angiotensin II is Pro-Phe-Ile-Met-Tyr-Val-Asp-Arg.
1Step 1: Determine Trypsin Cleavage
Trypsin cleaves at the carboxyl side of basic amino acids, such as Arg. Since the trypsin product includes a dipeptide of Asp-Arg, this means Arg is at the C-terminus of that dipeptide. The remaining fragment is a hexapeptide comprising the amino acids Ile, Met, Phe, Pro, Tyr, and Val.
2Step 2: Analyze Cyanogen Bromide Cleavage
Cyanogen bromide cleaves at the C-terminus of methionine (Met). It produces a dipeptide Pro-Phe, indicating that Phe is after a Met in the sequence, and the remaining amino acids Asp, Arg, Ile, Met, Tyr, Val form a hexapeptide.
3Step 3: Assess Chymotrypsin Cleavage
Chymotrypsin cuts peptide bonds following aromatic amino acids (Phe, Tyr, Trp). It creates two tetrapeptides: one contains Asp, Arg, Tyr, and Val, and the other containing Ile, Met, Phe, and Pro. This indicates that an aromatic amino acid in one tetrapeptide sequence or the other is followed by the cleavage.
4Step 4: Conclusion from Chymotrypsin and Cyanogen Bromide Data
Since Pro-Phe cannot be cleaved by carboxypeptidase and chymotrypsin, Pro is likely at the N-terminus and the dipeptide Pro-Phe forms the N-terminal part of the sequence. Given chymotrypsin's cleavage points, and the dipeptide Pro-Phe, Pro is at the N-terminus of the tetrapeptide comprising (Ile, Met, Pro, Phe).
5Step 5: Assemble the Complete Sequence
Joining all information: Pro-Phe confirms Pro is followed by Phe. The dipeptide Asp-Arg from trypsin positions Arg at the C-terminus. Met follows Ile as indicated by cyanogen bromide cleavage for a dipeptide after Met, and given the tetrapeptides, Tyr and Val most logically fill the sequence between Asp and Arg. This gives Pro-Phe-His-Ile-Tyr-Val-His-Arg as the sequence, matching the di-, tetra-, and hexapeptides obtained by enzymatic cleavage.
Key Concepts
Amino Acid CompositionEnzyme CleavagePolypeptide Analysis
Amino Acid Composition
Understanding the amino acid composition is key to solving protein sequencing problems. Every protein is made up of a specific order of amino acids, each of which contributes to the protein's characteristics and function. In this exercise, the amino acid composition provided is: Aspartic Acid (Asp), Arginine (Arg), Isoleucine (Ile), Methionine (Met), Phenylalanine (Phe), Proline (Pro), Tyrosine (Tyr), and Valine (Val).
These building blocks are given in random order but are key to deciphering the sequence of the polypeptide hormone, angiotensin II. By understanding which amino acids are present in the polypeptide and their respective properties, we can begin to determine how different enzymes will interact with this sequence.
These building blocks are given in random order but are key to deciphering the sequence of the polypeptide hormone, angiotensin II. By understanding which amino acids are present in the polypeptide and their respective properties, we can begin to determine how different enzymes will interact with this sequence.
- Amino acids like Arg have basic side chains, making them targets for enzymes like trypsin.
- Met contains a sulfur atom, which is specifically cleaved by cyanogen bromide.
- Aromatic amino acids like Phe and Tyr are typically recognized by chymotrypsin.
Enzyme Cleavage
Enzyme cleavage involves breaking down a protein into smaller peptides using specific enzymes. Each enzyme cleaves at specific sites determined by the chemical structure of the amino acids.
**Trypsin Cleavage**
Trypsin cleaves at the carboxyl side of basic amino acids like Arginine (Arg). In this scenario, trypsin yielded a dipeptide of Asp-Arg, indicating Arg is at the end of this segment.
**Cyanogen Bromide Cleavage**
Cyanogen bromide specifically cleaves at the carboxyl side of Methionine (Met). The result was a dipeptide Pro-Phe, which tells us Phe follows Met in sequence.
**Chymotrypsin Cleavage**
Chymotrypsin targets aromatic amino acids such as Phe and Tyr, resulting in two tetrapeptides. However, it did not cleave the dipeptide Pro-Phe, implying Pro is the N-terminal amino acid.
**Trypsin Cleavage**
Trypsin cleaves at the carboxyl side of basic amino acids like Arginine (Arg). In this scenario, trypsin yielded a dipeptide of Asp-Arg, indicating Arg is at the end of this segment.
**Cyanogen Bromide Cleavage**
Cyanogen bromide specifically cleaves at the carboxyl side of Methionine (Met). The result was a dipeptide Pro-Phe, which tells us Phe follows Met in sequence.
**Chymotrypsin Cleavage**
Chymotrypsin targets aromatic amino acids such as Phe and Tyr, resulting in two tetrapeptides. However, it did not cleave the dipeptide Pro-Phe, implying Pro is the N-terminal amino acid.
- The specific cleavage patterns observed provide insights into the arrangement of amino acids.
- Understanding how these enzymes interact with the polypeptide enables us to deduce the sequence and structure of angiotensin II.
Polypeptide Analysis
Polypeptide analysis allows us to deduce the sequence of amino acids in a protein. By applying enzyme cleavage data, we can determine the order of these amino acids.
Start by analyzing the data from all three cleavages. The key observations involve linking segments:
Combining these observations, we realize that Pro is at the N-terminus confirmed by Pro-Phe's resistance to cleavage, while Arg is at the C-terminus. With these anchor points and sequential logic, we determine the full sequence of angiotensin II as Pro-Phe-Ile-Met-Tyr-Val-Asp-Arg.
Start by analyzing the data from all three cleavages. The key observations involve linking segments:
- Trypsin produces a dipeptide Asp-Arg, identifying the C-terminus of the chain.
- Cyanogen bromide results in a dipeptide proline-Phenylalanine (Pro-Phe), confirming Phe following Met.
- The chymotrypsin cleavage results in two tetrapeptides, establishing internal connections among the amino acids.
Combining these observations, we realize that Pro is at the N-terminus confirmed by Pro-Phe's resistance to cleavage, while Arg is at the C-terminus. With these anchor points and sequential logic, we determine the full sequence of angiotensin II as Pro-Phe-Ile-Met-Tyr-Val-Asp-Arg.
Other exercises in this chapter
Problem 13
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. \(5^{\prime} \ldots\) GCCAUGUUUCCGAGUUAUCCCAA
View solution Problem 15
Acetylating agents such as acetic anhydride react preferentially with primary amines, iodoacetate reacts preferentially with sulfhydryl groups (see Tools of Bio
View solution Problem 18
You have discovered a novel protein that has a \(\mathrm{pI}=5.5\). To study the functional properties of this new protein, your research group has made a mutan
View solution