Chapter 25

Biochemistry: Concepts and Connections · 16 exercises

Problem 1

A random-sequence polyribonucleotide produced by polynucleotide phosphorylase, with CDP and ADP in a \(5: 1\) molar ratio stimulated the incorporation of proline, histidine, threonine, glutamine, asparagine, and lysine in a cell- free translation system in the following proportions: \(100,23.4,20,3.3,3.3\), and \(1.0\), respectively. What does this experiment reveal about the nucleotide composition of coding triplets for these six amino acids?

3 step solution

Problem 4

When polynucleotides are synthesized with repeating triplets of nucleotide residues, one, two, or three different polypeptide chains will be produced in cell-free synthesis. (a) Explain why these different results are possible. (b) Predict polypeptides produced when the following are used with an E. coli system: (GUA) \()_{11},(\mathrm{UUA})_{\mathrm{s}-}\)

4 step solution

Problem 5

Although the Shine-Dalgarno sequences vary considerably in different genes, they include examples like GAGGGG that could serve as code-in this case, for Glu-Gly. Does this imply that the sequence Glu-Gly cannot ever occur in a protein, lest it be read as a Shine-Dalgamo sequence? Speculate.

4 step solution

Problem 6

According to wobble rules, what codons should be recognized by the following anticodons? What amino acid residues do these correspond to? (a) \(5^{\prime}-1 \mathrm{CC}-3^{\prime}\) (b) \(5^{\prime}-\mathrm{GCU}-3^{\prime}\)

6 step solution

Problem 7

In the carly days of ribosome research, before the exact role of ribosomes was clear, a rescarcher made the following observation. She could find, in sedimentation experiments on bacterial lysates, not only \(30 \mathrm{~S}, 50 \mathrm{~S}\), and \(70 \mathrm{~S}\) particles, but also some particles that sedimented at about \(100 \mathrm{~S}\) and \(130 \mathrm{~S}\). When she treated such a mixture with EDTA, everything dissociated to \(30 \mathrm{~S}\) and \(50 S\) particles. Upon adding divalent ions, she could regain \(70 S\) particles but never \(100 \mathrm{~s}\) or \(130 \mathrm{~S}\) particles. (a) Suggest what the \(100 \mathrm{~S}\) and \(130 \mathrm{~S}\) particles might represent, in light of current knowledge of protein synthesis. What important discovery did the researcher miss? (b) Why do you think reassociation to \(100 S\) and \(130 S\) particles did not work?

5 step solution

Problem 9

What is the minimum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons?

3 step solution

Problem 10

Suppose that the probability of making a mistake in translation at each translational step is a small number, \(\delta\). Show that the probability, \(p\), that a given protein molecule, containing \(n\) residues, will be completely crror-free is \((1-\delta)^{n}\).

4 step solution

Problem 11

Assume that the translational error frequency, \(\delta\), is \(1 \times 10^{-4}\). (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000 -residue protein.

4 step solution

Problem 15

The antibacterial protein colicin \(E 3\) is an effective inhibitor of protein synthesis in bacteria. This protein is a nuclease, specifically attacking a phosphodiester bond near the \(3^{\prime}\) end of the \(16 \mathrm{~S}\) RNA. Suggest a mechanism for the effect of colicin E3 on translation.

4 step solution

Problem 17

The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. Can you think of a reason why polyG was not used as a translation template in these experiments?

5 step solution

Problem 19

Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?

3 step solution

Problem 20

The \(5^{\prime}\) sequence for the mRNA for E. coli ribosomal Llo protein is shown below. Identify the Shine-Dalgarno sequence and the initiator codon. $$ 5^{\prime} \text { - CUACCAGGAGCAAAGCUAAUGGCUUUA }-3^{\prime} $$

2 step solution

Problem 21

Chaperones are generally thought to facilitate protein folding. What additional functions do mitochondrial chaperones perform?

5 step solution

Problem 22

Suppression of a nonsense mutation involves a change in nucleotide sequence of a tRNA molecule. (a) What part of the tRNA molecule is changed? (b) How might this affect translation globally within a cell? (c) Why does such a mutation usually not have deleterious effects?

3 step solution

Problem 24

A nonsense mutation is a substitution mutation that creates a chain- terminating codon in the mRNA corresponding to the mutant gene. Identify three substitution mutations that could change a tryptophan codon to a nonsense triplet.

3 step solution

Problem 25

A nonsense codon can be suppressed. Suppression is a mutation at an unlinked site that restores wild-type function at the mutant site without changing the original mutation. Suppression of nonsense mutations was found to alter the structures of particular tRNAs. Consider a nonsense mutation resulting from alteration of a trp codon and identify a specific mutation in a tRNAencoding gene that could result in translation of the nonsense codon.

6 step solution

Show/ page