Problem 20 - Biochemistry: Concepts and Connections

Question

The \(5^{\prime}\) sequence for the mRNA for E. coli ribosomal Llo protein is shown below. Identify the Shine-Dalgarno sequence and the initiator codon. $$ 5^{\prime} \text { - CUACCAGGAGCAAAGCUAAUGGCUUUA }-3^{\prime} $$

Step-by-Step Solution

Answer

The Shine-Dalgarno sequence is 'AGGA', and the initiator codon is 'AUG'.

Step 1: Identify the Shine-Dalgarno Sequence

The Shine-Dalgarno (SD) sequence in bacteria is typically located upstream from the start codon and is rich in purines (adenine and guanine). It usually appears as AGGAGG or similar. In this mRNA sequence, "CUACCAGGAGCA" contains "AGGA", which is likely the Shine-Dalgarno sequence.

Step 2: Identify the Initiator Codon

The initiator codon in most organisms, including E. coli, is AUG which codes for methionine and signals the start of protein synthesis. In the sequence provided, the initiator codon is "AUG", which appears right after the Shine-Dalgarno sequence as "AUGGCUUUA".

Key Concepts

Initiator Codon

In the world of genetics, the initiator codon is like a green light signaling the start of protein synthesis. This small but essential component is usually the three nucleotides: adenine (A), uracil (U), and guanine (G), known as AUG. It serves the primary role of initiating the translation process of mRNA (messenger RNA) into a protein sequence.
In E. coli and many other organisms, AUG is recognized as the start of translation and dictates the beginning of protein formation. This initiator codon codes for the amino acid methionine, which is always the first amino acid in newly formed proteins. However, in some bacterial species, the alternative initiator codons GUG or UUG can also be used, although less frequently.
The presence of the initiator codon ensures that the ribosome assembles correctly on the mRNA so it can start the journey of protein synthesis efficiently. It's essential for aligning the ribosome at the proper reading frame, thereby ensuring that the rest of the mRNA is read correctly so that the cellular machinery can synthesize a protein accurately from the genetic code.

mRNA Translation

mRNA translation is a crucial biological process that transforms genetic information from mRNA into functional proteins. This process occurs in several stages and involves complex interactions.
It all starts when the mRNA, transcribed from DNA, travels from the nucleus to the cytoplasm. The ribosome, the cell's "protein factory," binds to the mRNA to begin the translation process. The ribosome reads the mRNA sequence from the 5' end, identifying codons or three-nucleotide sequences that each code for a specific amino acid.

• The translation begins with the recognition of the start codon, usually AUG.
• tRNA molecules bring amino acids to the ribosome, each tRNA matching with a codon on the mRNA through its anticodon.
• The ribosome facilitates the formation of peptide bonds between the amino acids, elongating the protein chain.
• Finally, translation ends when a stop codon (UAA, UAG, or UGA) is reached, signaling the release of the newly synthesized protein.

This multi-step process is vital for cell function, as proteins are responsible for countless tasks within the biological system, including building cellular structures, facilitating chemical reactions, and regulating biological pathways.

Bacterial Protein Synthesis

Bacterial protein synthesis is an essential process enabling bacteria to grow, multiply, and perform various functions. Unlike eukaryotes, bacteria have a streamlined method for translating mRNA into protein due to the absence of a nuclear membrane. This allows translation to begin even while the mRNA is still being transcribed.
The Shine-Dalgarno sequence plays a significant role in bacterial protein synthesis. Located just upstream of the start codon on the mRNA, it is a purine-rich sequence that helps recruit the ribosome to the correct start site for protein synthesis.

• The small ribosomal subunit identifies and binds to the Shine-Dalgarno sequence, securing the mRNA for translation.
• The initiator codon, usually AUG, follows this sequence, ensuring the ribosome is correctly positioned to start translating the mRNA into protein.
• Subsequently, the larger ribosomal subunit joins to form a complete ribosome, ready to translate the remaining mRNA into a functional protein.

This co-transcriptional translation and initiation by the Shine-Dalgarno sequence enable bacteria to respond rapidly to environmental changes, making them efficient and quick in adapting to various conditions. Such efficiency is key to bacterial survival and success across diverse environments.