Problem 9

Question

An individual's set of unique ___________ can be used as a DNA profile. a. DNA sequences b. SNPs c. short tandem repeats d. all of the above

Step-by-Step Solution

Verified
Answer
d. all of the above
1Step 1: Understanding DNA Profiling
To understand DNA profiling, recognize that it involves analyzing specific parts of an individual's DNA. DNA sequences, single nucleotide polymorphisms (SNPs), and short tandem repeats (STRs) are all different parts or types of markers within an individual's DNA that can be used for this analysis.
2Step 2: Evaluate Each Option
Option (a) DNA sequences represent the entire sequence of nucleotide bases in an individual's DNA. Option (b) SNPs are variations at a single position in a DNA sequence that occur in a significant portion of a population. Option (c) STRs are repeating sequences of 2-6 base pairs of DNA. Each can be used uniquely for DNA profiling.
3Step 3: Combine the Information
Since DNA profiling can use various types of genetic markers, it's important to recognize that using a combination of these approaches provides a more thorough and reliable profile. Hence, each of the options (a), (b), and (c) can be used individually or together for a DNA profile.
4Step 4: Determine the Best Answer
Given the descriptions, since each option provides a method for DNA profiling, the correct answer is (d) all of the above, as all these sets of unique identifiers can be used for an individual's DNA profile.

Key Concepts

DNA sequencesSingle Nucleotide Polymorphisms (SNPs)Short Tandem Repeats (STRs)
DNA sequences
DNA sequences are the fundamental blueprint of life, providing the instructions needed for an organism to develop, survive, and reproduce. They consist of long chains of molecules called nucleotides, which are arranged in a specific order to form the complete set of instructions for a living being. These sequences are composed of four types of nucleotides: adenine (A), thymine (T), cytosine (C), and guanine (G). The order of these nucleotides, known as the DNA sequence, determines the information available for building, maintaining, and regulating the cells and tissues of an organism.
It's important to understand that while the overall arrangement of nucleotides is similar among all humans, minute variations in DNA sequences contribute to each individual's unique genetic makeup. These variations make DNA sequences essential in the field of DNA profiling, which seeks to identify individuals based on their unique genetic information.
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms, commonly known as SNPs, are the most common type of genetic variation among people. A SNP represents a difference in a single nucleotide—a specific building block of DNA—that occurs at a specific position in the genome. For instance, some individuals might have the DNA sequence AAGCCTA, while others might have AAGCTTA at a specific location.
These tiny differences, known as single nucleotide variations, occur roughly once in every 300 nucleotides, which means there are roughly 10 million SNPs in the human genome. SNPs can act as biological markers, helping scientists locate genes that are associated with disease. They are valuable in understanding genetic predispositions to certain health conditions.
Importantly, SNPs can also be passed down through generations, making them a crucial tool in tracing lineage and ancestry. They enable researchers and forensic scientists to compare DNA samples on a very precise level, an essential feature for DNA profiling and identifying individuals accurately.
Short Tandem Repeats (STRs)
Short Tandem Repeats (STRs) are another significant aspect of DNA profiling. They consist of sequences of DNA where a short motif of 2 to 6 base pairs is repeated several times in a row. For example, a repeat of the sequence 'GATA' might be found repeated five times, resulting in the sequence 'GATAGATAGATAGATAGATA'.
STRs are highly variable among individuals, even close relatives. This high level of variation is due in part to the number of repeat units at a given STR location, which can be different from one person to another. This variability makes STRs extremely useful in forensic science, particularly for identifying individuals in criminal cases or in determining family relationships.
Because STR patterns are highly individualized, they are key components used in constructing a DNA profile, offering great reliability in distinguishing between people. Analyzing STRs involves comparing the number of repeats at a specific locus, providing a comprehensive and unique genetic signature for every individual.