Problem 1
Question
Given the following sequence of mRNA, what would the resulting amino acid sequence be? $$AUGAAACGGGGACCAAUGGAUAACUAA$$
Step-by-Step Solution
Verified Answer
The amino acid sequence is Met-Lys-Arg-Gly-Pro-Met-Asp-Asn.
1Step 1: Understand the mRNA Codons
mRNA sequences are read in groups of three nucleotides called codons. Each codon corresponds to a specific amino acid or a stop signal in protein synthesis. For the given mRNA sequence "\(AUGAAACGGGGACCAAUGGAUAACUAA\)", we must identify these triplet groups.
2Step 2: Segment mRNA into Codons
Separate the mRNA sequence into codons: \(AUG\), \(AAA\), \(CGG\), \(GGA\), \(CCA\), \(AUG\), \(GAU\), \(AAC\), \(UAA\). Each triplet represents a specific codon.
3Step 3: Translate Codons into Amino Acids
Use the genetic code to translate each codon into its respective amino acid. The sequence translates as follows:- \(AUG\): Methionine (start codon)- \(AAA\): Lysine- \(CGG\): Arginine- \(GGA\): Glycine- \(CCA\): Proline- \(AUG\): Methionine- \(GAU\): Aspartic acid- \(AAC\): Asparagine- \(UAA\): Stop (termination of translation)
4Step 4: Compile the Amino Acid Sequence
Combine the translated amino acids, stopping at the first stop codon. The resulting amino acid sequence is: Methionine-Lysine-Arginine-Glycine-Proline-Methionine-Aspartic acid-Asparagine. The stop codon \(UAA\) signals the end of translation.
Key Concepts
CodonsAmino Acid SequenceGenetic CodeProtein Synthesis
Codons
Understanding codons is essential to grasp how mRNA translation works. A codon is a sequence of three nucleotides on an mRNA strand that corresponds to a specific amino acid or a stop signal during protein synthesis. Think of them as the words in the genetic language – each word (codon) stands for a specific instruction to build proteins. For example, in the mRNA sequence given above, the codons are segmented into groups like AUG, AAA, CGG, and so forth. Each of these triplet combinations tells the cellular machinery which amino acid to add next in the chain.
Amino Acid Sequence
The amino acid sequence is the direct result of translating the sequence of codons in an mRNA molecule. After segmenting the mRNA into its respective codons, each one is translated into an amino acid, following the guidance of the genetic code. This process builds the primary structure of a protein.
- For instance, the mRNA codon AUG translates to Methionine, which often acts as the start signal for protein synthesis.
- Continuing with AAA which codes for Lysine, and CGG for Arginine, the process sequentially builds the chain.
Genetic Code
The genetic code is the set of rules by which the information encoded within mRNA is translated into proteins by living cells. It is essentially a dictionary that matches each of the 64 possible mRNA codons with their respective amino acids or stop signals.
- It's universal, nearly the same across all organisms, which showcases the evolutionary link between all life forms.
- Each amino acid can be specified by more than one codon due to the redundancy of the genetic code.
Protein Synthesis
Protein synthesis is the process in which cells make proteins, crucial for building cellular structures and carrying out functions. This process occurs in two main stages: transcription and translation. In translation, which concerns us here, the mRNA sequence is decoded to build a chain of amino acids, forming a specific protein.
- Translation begins at the start codon (AUG), and the ribosome reads the mRNA in three-nucleotide steps (codons).
- Each codon attracts a tRNA molecule carrying the appropriate amino acid.
- This process continues until a stop codon (like UAA) is reached, signaling the completion of the protein chain.